Search Results | SCGE Toolkit

SCGE Consortium Home | About SCGE Toolkit | Contact Us | Citing the Toolkit | License

Filter By ...

Animal (5)

Cell (2)

Immortalized (1)

Immortalized Fibroblast (unspecified) (1)

Human (1)

Mouse (6)

Transgene Reporter

tdTomato (6)

Table View
List View

7 results for search term 'Ai9' in category Model System

Ai9 mouse Model System - [In Vivo] [Delivery Systems, AAV tropism, Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System name : Ai9 mouse description : Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent guide : Sa_Ai9_L Sa_Ai9_R Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Ai9-SauSpyCas9 mouse Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System name : Ai9-SauSpyCas9 mouse description : Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9 Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Ai9 mouse (BCM) Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System name : Ai9 mouse (BCM) description : Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Ai9 mouse immortalized fibroblasts Model System - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: category : Model System name : Ai9 mouse immortalized fibroblasts description : Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
HEK-293T with Ai9 transient reporter assay Model System - [In Vitro] [Delivery Systems] [Human] Matched Fields: category : Model System name : HEK-293T with Ai9 transient reporter assay description : HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Ai14 mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System guide : Ai14 gRNA Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Ai14 mouse (congenic) Model System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System guide : Ai14 gRNA Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

7 results for search term 'Ai9' in category Model System

Type	Organism	Subtype	Name	Description	Source	View Associated...
Animal	Mouse		Ai9 mouse	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	The Jackson Laboratory	Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Animal	Mouse		Ai9-SauSpyCas9 mouse	Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.	Baylor College of Medicine	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Animal	Mouse		Ai9 mouse (BCM)	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	Baylor College of Medicine	Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Cell	Mouse	Immortalized Fibroblast (unspecified)	Ai9 mouse immortalized fibroblasts	Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice		Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Cell	Human	Immortalized	HEK-293T with Ai9 transient reporter assay	HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Animal	Mouse		Ai14 mouse	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Animal	Mouse		Ai14 mouse (congenic)	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

Type	Organism	Subtype	Name	Description	Source	View Associated...